This site is not maintained. Click here for the new website of Richard Dawkins.

← Evolution's Footprints in Human Genome Precisely Tracked Using New Approach

Evolution's Footprints in Human Genome Precisely Tracked Using New Approach - Comments

Lemniscate's Avatar Comment 1 by Lemniscate

This article isn't very clear on whether these methods are useful primarily for finding out what genes are undergoing selection now or for finding which genes underwent selection in the evolution of modern humans. Surely the latter is more difficult and more interesting, yet the examples given were of genes where selection appears to be occurring now.

Mon, 11 Jan 2010 15:01:00 UTC | #430934

Billy Sands's Avatar Comment 2 by Billy Sands

Lemniscate, to find genes that recently underwent a selective sweep, you look for linkage disequilibrium http://en.wikipedia.org/wiki/Linkage_disequilibrium

Mon, 11 Jan 2010 15:33:00 UTC | #430953

Reckless Monkey's Avatar Comment 3 by Reckless Monkey

About 8 years ago I heard a geneticist taking about where we are with reading vs' understanding genetics. His comment was we were at the "Dick and Jane" level of genetic literacy. It's been a while now and I'm just wondering what the equivalent reading age is now? How long before we get to Dr Seuss?

Mon, 11 Jan 2010 23:45:00 UTC | #431140

King of NH's Avatar Comment 4 by King of NH

Oh, yay, wonderful. Umm, yeah... No, no, it's good.

It's just, well...

"earlier methods for detecting these signals are limited, highlighting relatively large chunks of the genome that are hundreds of thousands to millions of genetic letters or "bases" in length, and that can contain many genes."

""Composite of Multiple Signals" or CMS, enabled them to dramatically narrow the size of the candidate regions, reducing them from an average of eight genes per region to one. Moreover the number of candidate genetic changes was reduced from thousands to just a handful, helping the researchers tease out the needles from the haystack."


I mean, how's a grad student going to pay for his beany-weanies without 13 hours a day comparing "caggtcgctgagatcgatagctagttcgatcgatatagctagctagctagctttcgatcgctgctag" to "caggtcgctgagatcgatagctagttcgatctatatagctagctagctagctttcgatcgctgctag"? Why does nobody think of the poor grad student? Know what? To hell with you scientists. I can get a PhD from Patriot University for 2 grand, less than a handful of text books'd be if I stick around here. Oh, and I'm taking my beany-weanies and my ramen noodles with me.

Tue, 12 Jan 2010 00:38:00 UTC | #431151

Carl Sai Baba's Avatar Comment 5 by Carl Sai Baba

Another vague press release from Science Daily.

Thanks to BillySands for telling us that linkage disequilibrium can be used for this. It would have been nice of Science Daily gave us any kind of clue.

Tue, 12 Jan 2010 04:22:00 UTC | #431171