Comment

← Evolution's Footprints in Human Genome Precisely Tracked Using New Approach

Oh, yay, wonderful. Umm, yeah... No, no, it's good.

It's just, well...

"earlier methods for detecting these signals are limited, highlighting relatively large chunks of the genome that are hundreds of thousands to millions of genetic letters or "bases" in length, and that can contain many genes."

""Composite of Multiple Signals" or CMS, enabled them to dramatically narrow the size of the candidate regions, reducing them from an average of eight genes per region to one. Moreover the number of candidate genetic changes was reduced from thousands to just a handful, helping the researchers tease out the needles from the haystack."

I mean, how's a grad student going to pay for his beany-weanies without 13 hours a day comparing "caggtcgctgagatcgatagctagttcgatcgatatagctagctagctagctttcgatcgctgctag" to "caggtcgctgagatcgatagctagttcgatctatatagctagctagctagctttcgatcgctgctag"? Why does nobody think of the poor grad student? Know what? To hell with you scientists. I can get a PhD from Patriot University for 2 grand, less than a handful of text books'd be if I stick around here. Oh, and I'm taking my beany-weanies and my ramen noodles with me.

Permalink Tue, 12 Jan 2010 00:38:00 UTC | #431151