This site is not maintained. Click here for the new website of Richard Dawkins.

Comments by King of NH

Go to: Microbes breathe life into oxygen theory

King of NH's Avatar Jump to comment 9 by King of NH

""Thanks glenister_m. Seems a more reasonable explanation. Would nevertheless have been a nice firework. But nobody there to enjoy it."

From the outside looking in maybe, but not the inside looking out! :-p "

Some extra-galactic Phil Plait with tentacle arms furiously tapping away the tweet, "Look at this fireball from the area of Sol. We think that was a planet!"

Sun, 28 Mar 2010 23:38:00 UTC | #453530

Go to: The fires of Hell are real and eternal, Pope warns

King of NH's Avatar Jump to comment 115 by King of NH

Ratzinger should know, since that's where he's obviously from.

Tue, 23 Feb 2010 04:14:00 UTC | #443346

Go to: Atheists are wrong to claim science and religion are incompatible, Church of England says

King of NH's Avatar Jump to comment 11 by King of NH

But they are delusional. Either they know this and they're lying (probably lying so well, they believe themselves) or they are suffering some form of mental illness: they are self deluded or just deluded.

What really irritates me is their claim, though. They say that religion deals with "other questions." What other questions? What is the method by which you answer those questions, and then verify the answers? To what level of certainty can one expect the "inerrant word of God" to be?

I don't have a problem with the idea that there is a god so much as the lazy, dishonest, and self aggrandizing methods used to make such a conclusion. If science were to discover a god, that is, if there was sufficient independently verifiable, testable, falsifiable, and logical evidence that there was a god, I would have no choice but to say, "Oh, well, there we are then, aren't we?"

Perhaps I speak only for myself. But it seems to me they think that when atheists attack religion, we are attacking the end product: God. What they do not seem to realize is that we are attacking the foundation of religion: the idea that one can know a truth independent of shared reality. I don't care if there is or is not a god, though I'm pretty certain there is not. What I do care about is religion pretending to be a useful method of thought. It is not. If I am wrong, then it should be easy enough to derive a valid and true claim, using only religion and not science, that can then be tested for accuracy.

Tell me, priests, ministers, rabbis, clerics, and shaman, what can we expect of H1N1 next season?

Sat, 13 Feb 2010 05:22:00 UTC | #441022

Go to: Subjection and Escape - Parts 2 and 3

King of NH's Avatar Jump to comment 28 by King of NH

I'm quite speechless. Thank you Lisa for telling us such a personal story for the public good. It can't be easy reliving that.

Also, thanks to the other posters above for wording our appreciation better than I seem able.

Thu, 04 Feb 2010 20:02:00 UTC | #438562

Go to: Ray Comfort's Darwin Comic,

King of NH's Avatar Jump to comment 3 by King of NH

Wow! Um. I thought people had already explained all this to Ray. *sigh*

What is really depressing is I now have people trying to argue with me using Ray's summaries of evolution and science. They get really pissed when I can only stop laughing long enough to ask, "Ray Comfort?"

But he is reaching people, obviously. We really need to step up the campaign. At least The God Delusion is getting out there. We need more books like that. Maybe we could write a similar cartoon (theists like pikshure buks) showing the book outlining creationism also has people living in the bellies of fish, men living for hundreds of years, talking snakes, donkeys, and demons, how this book was the real cause of Nazi Germany, how this book endorsed slavery and genocide...

I see how mad the world is getting and just want to curl up and cry. It's hard to have a battle of wits when the other side shows up with guns.

Sun, 31 Jan 2010 15:08:00 UTC | #437083

Go to: Can One Be Good Without God?

King of NH's Avatar Jump to comment 20 by King of NH

FAIL.. I don't need no congregation, I don't need no flock control.


And if some atheists don't agree? Are they still true atheists?

A tad unfair to you, DoctorE, I will grant, since I have taken your point further than you may have. But let me be kind and assume you take your position only as an individual, and that you hope others will take a position that fits with their own best interests. If this is the case, I don't see how Epstein failed in any way, or why you would say he did. If my more unkind summation was closer to the mark, then I wonder aloud, "Why are you on this site?"

Humans are social creatures. Had churches rejected dogma and formed learned groups with the intention of discussing, researching, and solving the earth's problems, Dawkins, Hitchens, Harris, Dennet, PZ, Randi... They would all be just some iconoclast smearing graffiti on the walls of the Louvre for the fun of it. The group is not the problem with religion. Communities are not bad. Dogmatic authority is. I think humanists and other atheists forming communities to give comfort and support and to enact social progress, while open to certain problems, is more beneficial than preventing such groups will be. The one thing that is certain, though, is that nobody is forcing anybody else to join such groups either by medieval law or by threats of damnation. Those of us that want to group together offer only community, and hopefully a community with passionate disagreement, heated debates, and all of it in good fun and friendship.

Mon, 25 Jan 2010 23:03:00 UTC | #435214

Go to: Haiti earthquake: religion fills the void left by aid agencies

King of NH's Avatar Jump to comment 19 by King of NH

I don't see how religion is filling any void. It is telling people lies, using the tragedy to peddle their snake oil, and all in all acting like a jerk.

Stop the sinning? Seriously? What sort of sick and twisted message is that? "Your sister died a slow and agonizing death starving and dehydrated within earshot of rescue for six days because she was a sinner." Let me be perfectly clear. I will break your jaw, rip it out, and stab you with it repeatedly if you ever "console" me with something like this, and I will only do so because I am a peaceful man and wouldn't do to you what I want to do.

Moral high ground my ass. Why are the atheists the ones giving 100% financial support to MSF and the Red Cross then? Why is the real help secular?

Mon, 25 Jan 2010 19:12:00 UTC | #435143

Go to: Evolution's Footprints in Human Genome Precisely Tracked Using New Approach

King of NH's Avatar Jump to comment 4 by King of NH

Oh, yay, wonderful. Umm, yeah... No, no, it's good.

It's just, well...

"earlier methods for detecting these signals are limited, highlighting relatively large chunks of the genome that are hundreds of thousands to millions of genetic letters or "bases" in length, and that can contain many genes."

""Composite of Multiple Signals" or CMS, enabled them to dramatically narrow the size of the candidate regions, reducing them from an average of eight genes per region to one. Moreover the number of candidate genetic changes was reduced from thousands to just a handful, helping the researchers tease out the needles from the haystack."


I mean, how's a grad student going to pay for his beany-weanies without 13 hours a day comparing "caggtcgctgagatcgatagctagttcgatcgatatagctagctagctagctttcgatcgctgctag" to "caggtcgctgagatcgatagctagttcgatctatatagctagctagctagctttcgatcgctgctag"? Why does nobody think of the poor grad student? Know what? To hell with you scientists. I can get a PhD from Patriot University for 2 grand, less than a handful of text books'd be if I stick around here. Oh, and I'm taking my beany-weanies and my ramen noodles with me.

Tue, 12 Jan 2010 00:38:00 UTC | #431151

Go to: Voicing our disbelief

King of NH's Avatar Jump to comment 7 by King of NH

@God fearing Atheist

The problem is that no amount of philosophy, education, rational discussion, or even fresh baked cookies will end this debate. It will take these things combined with time.

How can someone like Hovind, Ham, or Comfort stand there and deny evolution? These men are not without access to the truth. They have been told the truth time after time. They don't care. And I would wager neither do most of their followers. So long as they have a comfort zone of fellow believers, they refuse to listen.

The only answer is to pick them off, one by one, growing our side as quickly as we shrink theirs. That is to say, you are that philosopher you hope for. For every mind you get to question, you help break the mirror.

By the way? Philosophy 101 is a joke. You'll need it to move on, but if you've spent much time on this site, you'll be amazed at how stupid much of "Great Western Thought" is (God must exist because I can imagine him).

Tue, 05 Jan 2010 03:06:00 UTC | #428620

Go to: Geosciences: Melt Rises to Earth's Surface Up to 25 Times Faster Than Previously Assumed

King of NH's Avatar Jump to comment 6 by King of NH

I'm calling dibs on sticking with the old magma flow model! Since I have no geology degree and am utterly baffled by how this actually pans out in real world consequences, I am in a perfect position to begin publishing.

Tue, 05 Jan 2010 02:31:00 UTC | #428614

Go to: Wired Science News for Your Neurons Top Scientific Breakthroughs of 2009

King of NH's Avatar Jump to comment 4 by King of NH

Awesome idea, rod-the-farmer! With the long life drug, gene therapy, and cancer breathalyzer I can now drink well into my 120's without accidentally knocking over my beer. Too bad the retirement age will be increased to 150 now.

Looking through the list, I feel a little guilty of my egocentric complaints of 2009. 2009 was an awesome year, even if not for me. Way to go science!

Sun, 03 Jan 2010 17:22:00 UTC | #428073

Go to: What Happened to the Hominids Who Were Smarter Than Us?

King of NH's Avatar Jump to comment 23 by King of NH

There are certainly many ways a more intelligent species can go extinct despite, rather than because, of its intelligence. Our noble species could even be he culprit. A Georgia trailer park is sufficient evidence to the human breeding capacity. Or it could have been a virus, climate pressure, hell, space aliens are even a better explanation than they self reflected themselves to death (Richard, is it really THAT easy to get a PhD in evolutionary biology?).

But brain size and intelligence are only loosely correlated. Perhaps their brains were larger because they were less efficient. "Brainiac" was thousands of times larger than my iPod. Why did we stop using such a powerful computer? Was it just too much AI? Did we have to destroy Frank Herbert's thinking machines? Or was it just a simple "size doesn't matter" circumstance? Just maybe, the larger brain burned too many calories per thought to compete with a slightly improved homo- design using more proton pumps in nervous cells, or better transmitters and/or hormones, or tweaked receptor sites... Without tissue, it is very difficult to get solid answers.

When it comes to anthropology and paleontology, a guy I once borrowed money from gave the best advice (in a dark cornfield): Keep digging.

Thu, 31 Dec 2009 03:41:00 UTC | #427034

Go to: Religious Right Including Members Of Congress Pray For God To Stop The Health Care Bill

King of NH's Avatar Jump to comment 5 by King of NH

Okay, a deal then. Pass the original health care bill, public option, no cap, no preexisting conditions and all. Then, congress can put the bill on a podium in front of the chair. Republicans will then prey (sorry, pray) together. If the bill is still there after fervent prayer, God must be in favor of the bill and it goes off to the president for the final signature.

Then we lock all the Republicans in a bunker with no food or water. If after 40 days and 40 nights (I'm goin' strictly by the Good Book here) they aren't still chipper, then God must not be on their side after all.

I'm liking this God in politics thing. Hey, Beck! Yeah, God said shut the hell up.

Fri, 18 Dec 2009 20:47:00 UTC | #424425

Go to: It is not part of anyone’s culture to be abused

King of NH's Avatar Jump to comment 29 by King of NH

Vaal...

There is a fine line between justice and vengeance. We have built justice to prevent revenge. I want to personally beat this father to a bloody (both British and dictionary definition) heap. So to protect my own morality and sanity, I would prefer to leave it to courts and prisons.

This is a British crime, but there was an American philosopher of some sort, I can't remember who, that said (paraphrasing) of Western justice, "It is better that a thousand criminals run free than one innocent man should be unfairly punished." It is better that we are just, civil, and humane toward the even very worst of criminals then we should give in to vengeance.

Fri, 18 Dec 2009 15:44:00 UTC | #424327

Go to: It is not part of anyone’s culture to be abused

King of NH's Avatar Jump to comment 28 by King of NH

Or is it because authorities there are failing to use the powers for fear of creating offence?


Really? Because I am offended that 2,500 girls, supposedly protected by a civil nation ruled by law, have been sold for rape.

Fri, 18 Dec 2009 15:33:00 UTC | #424324

Go to: The God F.A.Q.

King of NH's Avatar Jump to comment 1 by King of NH

Haha! Brilliant.

100,000 (I'm guessing, but sure Richard has a better number) years of theological study is now completed. They should be happy.

Fri, 18 Dec 2009 15:22:00 UTC | #424319

Go to: Religion seen an 'oddity' by ministers, Archbishop says

King of NH's Avatar Jump to comment 52 by King of NH

Well, my dear Bishop, that's because religion is a problem, isn't it. Surely not to you. My strong desire to have people give me money and wait on me day and night is not a problem to me, especially if I can convince our president to order it so. But you see, there is the problem. You have ordered it so in your nation. It is a problem to everyone around you. Look at the devastation you leave in your wake. Europe has not thrived because of Christianity. History shows clearly that it has thrived despite your best efforts, and every shining moment of western culture was when Europe rose up and bitch slapped your cross dressing boys club homophobes.

Grow up and get over it. You're a bunch of grown men and women dressing in funny cloths and taking some very old fairy tales far too seriously, seemingly based only on the fact that they are very old. That is an oddity, even if it is a trait shared by a majority.

Seriously, if prayer could heal, wouldn't religion have been cured by now? If devotion to a god offered divine insight, wouldn't priests know it's all just a load of BS? If religion offers comfort and nourishment, why do churches need money? This is, in my humble opinion, proof that religion is not all it's cracked up to be. It is, indeed, a problem.

Fri, 18 Dec 2009 02:29:00 UTC | #424194

Go to: Lawsuit threatened over atheist councilman in NC

King of NH's Avatar Jump to comment 36 by King of NH

Great discussion over the Civil War! I have to agree with TheVirginian, but also give my kudos to Kmita for instigating the lesson.

I have bounced up and down the US east coast (as well as around the world, but mostly east coast) and have noticed a gigantic cultural divide. Being a New Englander, I honestly felt more at home in Singapore, Hong Kong, Dubai, and Vancouver than I do a mere 500 miles south of my home state.

It's not just a subjective feeling, either. Societal health measurements are in stark contrast between New England/New York and Georgia/Alabama. North Carolina, Virginia, and Florida seem to be holding out, and in some cases winning, but then you can see the ignorance spilling up the crest of the Appalachians, right through New England and into Maine.

Luckily, the shots fired have been few, and only fired by the truly insane, not yet the sane but religiously blinded (as is the case of many Muslim terrorists). But we are sliding into a civil war again none the less. Our last presidential election has brought the seething, ignorant, vicious, hate mongers out of their cess pools and into the media. Racism is again tolerated as a political opinion. Sarah Palin supporters now feel redeemed in their ignorance of science and wear it as a Real American(TM) badge of honor. The very fact that the news media made such a big deal of Obama's religion, questioning if he might be a Muslim, only reaffirmed the imaginary "Christian Nation" founding.

I hope that the raving hatred of the ignorant masses has its only possible positive outcome. I hope most people look at the batshit crazy and want no part of it.

Sun, 13 Dec 2009 19:53:00 UTC | #423119

Go to: Bah, Hanukkah

King of NH's Avatar Jump to comment 30 by King of NH

I agree with Hitch. It so extraordinarily gets on my nerves to have such a joyous time of year - with family, friends, and fresh new undershorts - ruined at every opportunity by Bible thumping brimstone preachers screaming that we're supposed to be bowing to his bloodthirsty tribal deity rather than drinking eggnog. The very idea of these rabid baboons of theocracy is to usurp the strong desire of humans to do good and use it to pressure them into signing up for a divisive, hateful ignorant community.

Hey, Christmas went from ancient acknowledgments of the solstice, to celebrations of Mithra-like embodiments of the solstice, to Christianity's "Birth of the Zombie Savior" holiday...

Screw it. Let's join in and hijack it in the name of science and reason! Do (nonflammable) experiments on the X-mas tree, explain the science of cooking a turkey or ham, measure snow fall and predict the rest of the season... We can rename it SciSolstice Day, the day when Sagan Clause brings all the good boys and girls telescopes, microscopes, and books on the Scopes Monkey Trial.

Fri, 11 Dec 2009 21:07:00 UTC | #422586

Go to: Feeding birds 'changes evolution'

King of NH's Avatar Jump to comment 19 by King of NH

Wait, did that guy say this is reversible? Like hell! Evolution never reverses. If people stop feeding the birds, they will simply die. If they are diverging from their parent species, it will be an extinction event, not a reversal in evolution.

It might be very interesting to study an actual extinction from divergence to end, but that's rather cold hearted (I know, the English ARE cold hearted, but even for them!). I say let the people enjoy the relationship, provided it is beneficial to both.

*side note: We just put up a bird feeder and have a mating pair of Cardinals using it. The male and the new fallen snow is quite a combination of holiday theme. Plus, the house cat is giddy with excitement.

Sun, 06 Dec 2009 00:44:00 UTC | #420551

Go to: Unreported World: The Battle for Israel's Soul

King of NH's Avatar Jump to comment 11 by King of NH

It seems the voting block of religious groups is the biggest problem. On the secular/rational/sane end, we encourage people to educated themselves about the issues, look critically at the candidates, and vote with reason. On the religious/fundamentalist/wacko side they simply say, "Vote for x."

Obviously, I still stand with voting intelligently on individual reasoning. But how can we possibly win? Any politician in any democracy will lose elections if this trend continues and they stand for reason, peace, cooperation, and secularism. The most solid "one voice" voting blocks are those of the religious, and the more extreme, the more adherent the voting block, the more favors they can gain from elected leaders, so the more extreme they get, the more power they wield...

I know Richard doesn't have all the answers, but come on guys... The Four Horsemen should have enough really smart friends to come up with a starting plan. Please?

The only small idea I have is continue to get people excited about science. It encourages critical thought, international cooperation, and spawns friendly competitive battles that, unlike wars, can be ended with a cold beer and some laughs.

Light bulbs work for the same reason in Israel as they do in Palestine. Yay, agreement!

Thu, 03 Dec 2009 16:58:00 UTC | #419940

Go to: Unreported World: The Battle for Israel's Soul

King of NH's Avatar Jump to comment 3 by King of NH

I hope their funding yanked. Unfortunately, here in America, fundamentalist and extremist wackos get tax breaks because it's "religion." The problem of religion is global and serious, but how do we stem the growth? I want to be optimistic, but it seems sanity is losing ground.

Thu, 03 Dec 2009 16:32:00 UTC | #419925

Go to: Black Hole Caught Zapping Galaxy Into Existence?

King of NH's Avatar Jump to comment 17 by King of NH

I wonder if this links back to http://prola.aps.org/abstract/PRD/v39/i4/p1123_1.

If so, we could be rooting out the final hiding places of Bigfoot and his Fairy Starmakers.

Thu, 03 Dec 2009 15:49:00 UTC | #419908

Go to: UPDATED: Nine Lessons and Carols for Godless People

King of NH's Avatar Jump to comment 20 by King of NH

Is it just me, or does atheism look more like a religion every day?


According to "Prophet Dawkins (May the Unicorn of Pink Invisibility give Peace to Him and His)" and the "Holy Son who is also His own Father and some other Spirit just because you can't have a Trinity without 3 Hitchens (yes, a very long title, but he does love to talk)" no, atheism is not a religion.

(Kidding! The Holy See and Messiah Dennet says Dawkins and Hitchens are false gods)

I do understand where you're coming from, but if you replace the theist objection "Atheism is a religion, too, because..." with "Punctuated Equilibrium is a religion, too, because" or "Socialism is a religion, too, because" or, or, or... you will see that the argument simple doesn't hold up. Why not dispense with the word "religion" all together and just say "any group" at that point?

They want "religion" and "religious" to mean "exemplary moral character" when it is aimed at them, but have it mean "blind, ignorant faith" when pointed at us. Sorry, but I'm not letting it pass.

Thu, 03 Dec 2009 15:37:00 UTC | #419905

Go to: Atheism is the new fundamentalism

King of NH's Avatar Jump to comment 161 by King of NH

SaintStephen:
"Grayling and Dawkins. Grayling and Dawkins... sounds like a drink served around Christmas time."

Awesome idea! We should have a contest to come up with the drink.

Mon, 30 Nov 2009 00:51:00 UTC | #418176

Go to: Atheism is the new fundamentalism

King of NH's Avatar Jump to comment 160 by King of NH

1) Doesn't A C Grayling look like he plays piano extraordinarily well? I don't know, perhaps he does.

2) Point 3 is more on topic than point 1

3) I would hardly call this a debate. The "for" side never really made a point. It seemed like accusing someone of murder, and the only thing the prosecution has to say is, "Well, he called me a bastard for accusing him! Of course he's guilty."

Mon, 30 Nov 2009 00:47:00 UTC | #418172

Go to: Evidence of life on Mars lurks beneath surface of meteorite, Nasa experts claim

King of NH's Avatar Jump to comment 34 by King of NH

Thank you j.mill... I might be turning too skeptical, but I'd rather fall off that side than the other. In this case, I think it has more to do with Sagan's advice: The more you want something to be true, the more careful you should be in accepting it is true.

Sun, 29 Nov 2009 15:27:00 UTC | #417924

Go to: Evidence of life on Mars lurks beneath surface of meteorite, Nasa experts claim

King of NH's Avatar Jump to comment 28 by King of NH

I can't seem to find any information on this study at Nasa's page. Maybe they don't think it's all that big of a deal. In fact, all Google searches lead me back to the Timesonline website in round about ways.

I'm not trying to be skeptical here. I do honestly want someone to smack me across my head with the study's abstract. But I must say if the claim was "Bigfoot found!" or "Jesus's Divinity Proven!" I would demand more evidence then I seem to want for "Tiny Aliens Found on 13M Year Old Frozen Rock!"

Why does it seem Nasa has no idea they did this study, or, to be kinder, have no idea people would want to know?

Sun, 29 Nov 2009 00:47:00 UTC | #417790

Go to: Atheism is the new fundamentalism

King of NH's Avatar Jump to comment 38 by King of NH

Normally, I dance around church services and cast evil spells on the the good Xians during Sundays, as all atheists do (a point I do hope they bring up in the debate, or all my effort is for naught), but I guess I can skip one Sunday and tune in. GMT -5, so I guess 1:45 in the afternoon. Perhaps time for a quick splash of un-holy water on a few of the close ones?

Sun, 29 Nov 2009 00:16:00 UTC | #417779

Go to: Mr. Deity and the Woman

King of NH's Avatar Jump to comment 16 by King of NH

Now hold on. How many complaints were there when they made the video of Adam accepting the ridiculous terms of eternal damnation and suffering because he saw a photo of Eve?

It's okay to make caricatures of men being dumb and doing anything for sex with a hot chick, but not caricatures of women being emotional and wholly incomprehensible to men? My Spidey Sense detects a double standard.

Tue, 24 Nov 2009 15:27:00 UTC | #416111